Effect of Multispecies Probiotics on Irritable Bowel Syndrome

A Randomized, Double-blind, Placebo-controlled Trial

Jun Sik Yoon; Won Sohn; Oh Young Lee; Sang Pyo Lee; Kang Nyeong Lee; Dae Won Jun; Hang Lak Lee; Byung Chul Yoon; Ho Soon Choi; Won-Seok Chung; Jae-Gu Seo

Disclosures

J Gastroenterol Hepatol. 2014;29(1):52-59.

Results

Participants

Of enrolled 50 patients, 49 (98%) patients were randomized to either probiotics or a placebo for 4 weeks. One patient refused to participate in this study; 49 patients (25 in the probiotics group and 24 in the placebo group) completed the study (Fig. 1).

Table 2 shows the baseline characteristics of the participants. Age, gender, IBS subtype, intensity of abdominal pain/discomfort, bloating, stool frequency, and consistency (according to the BSFS) were not different between the two groups.

Primary Efficacy End-points

The proportion of patients who received global relief of IBS symptoms at week 4 is shown in Figure 2. There was a significantly higher response rate in the probiotics group than in the placebo group: 68.0% (17/25) versus 37.5% (9/24) (P = 0.03).

(Enlarge Image)

Figure 2.

Comparison of global relief of irritable bowel syndrome (IBS) symptoms in the probiotics and placebo groups after 4 weeks of treatment. More patients in the probiotics group experienced global relief of IBS symptoms than in the placebo group: 68.0% (17/25) versus 37.5% (9/24) (P = 0.03). *P < 0.05.

Secondary Efficacy End-points

Relative to baseline, the intensity of abdominal pain (0–10 rating scale) at week 4 was significantly reduced in the probiotics group (3.2 ± 1.7→2.0 ± 1.9, P < 0.01), but not in the placebo group (3.1 ± 1.7→2.6 ± 1.4, P = 0.13) (Table 3). The intensity of abdominal discomfort and bloating was also reduced in the probiotics group but not in the placebo group. However, there was no significant difference in stool frequency and consistency between baseline and week 4 in either group. The change of abdominal pain relative to baseline was greater in the probiotics group than the placebo group, but it does not satisfy the statistical significance (−37.1 ± 46.3% vs −9.2 ± 57.1%, P = 0.07) (Table 4).

Fecal microflora was analyzed by real-time quantitative PCR to identify any alterations in intestinal microbiota after treatment with multispecies probiotics. Fecal microflora counts for each group were evaluated immediately before the start of treatment and at the end of treatment. Fecal microflora were analyzed in the 34 patients (17 each in the probiotics and placebo groups) who agreed to the collection of stool samples. Changes in the composition of fecal bacteria over the 4-week period are summarized in Table 5.

Compared with baseline, counts of B. lactis, L. rhamnosus and S. thermophilus at week 4 had increased in the probiotics group (B. lactis : 6.09 ± 1.23→7.57 ± 1.22 log₁₀ cells/g in feces, P < 0.01; L. rhamnosus : 2.80 ± 1.69→5.05 ± 1.43, P < 0.01; S. thermophilus : 4.81 ± 0.87→5.35 ± 1.28, P = 0.04). Meanwhile placebo group showed the increase of B. lactis counts (5.99 ± 0.52→6.54 ± 0.87 log₁₀ cells/g in feces, P = 0.04). Counts of B. longum, B. bifidum, L. acidophilus, and Escherichia coli subgroup, and Clostridium perfringens and Bacteroides group were unchanged in both groups.

Compliance and Adverse Events

The mean percentage of drugs taken to drugs prescribed was 96% in the probiotics group and 94% in the placebo group (P > 0.05). No adverse events or serious adverse events occurred in either group.

1 2 3 4

Next Section

Table 1. Oligonucleotides used for quantitative real-time polymerase chain reaction assays
Target groups or species	Primer names	Primer sequences (5'-3')	Reference
Total bacteria	341F	CCTACGGGAGGCAGCAG	Nakamura et al.[35]
Total bacteria	543R	ATTACCGCGGTGCTGG	Nakamura et al.[35]
Bifidobacterium group	F	TCGCGTC(C/T)GGTGTGAAAG	Rinttila et al.[36]
Bifidobacterium group	R	CCACATCCAGC(A/G)TCCAC	Rinttila et al.[36]
Bifidobacterium longum	BlonF	CAGTTGATCGCATGGTCTT	Ramirez-Farias et al.[37]
Bifidobacterium longum	BlonR	TACCCGTCGAAGCCAC	Ramirez-Farias et al.[37]
Bifidobacterium bifidum	BiBIF-1	CCACATGATCGCATGTGATTG	Matsuki et al.[38]
Bifidobacterium bifidum	BiBIF-2	CCGAAGGCTTGCTCCCAAA	Matsuki et al.[38]
Bifidobacterium lactis	BlactF	CCCTTTCCACGGGTCCC	Malinen et al.[39]
Bifidobacterium lactis	BlactR	AAGGGAAACCGTGTCTCCAC	Malinen et al.[39]
Lactobacillus group	F	AGCAGTAGGGAATCTTCCA	Rinttila et al.[36]
Lactobacillus group	R	CACCGCTACACATGGAG	Rinttila et al.[36]
Lactobacillus rhamnosus	LU-5	CTAGCGGGTGCGACTTTGTT	Song et al.[40]
Lactobacillus rhamnosus	RhaII	GCGATGCGAATTTCTATTAT	Song et al.[40]
Lactobacillus acidophilus	F-acid-IS	GAAAGAGCCCAAACCAAGTGATT	Haarman and Knol[41]
Lactobacillus acidophilus	R-acid-IS	CTTCCCAGATAATTCAACTATCGCTTA	Haarman and Knol[41]
Streptococcus thermophilus	ST-F	ACGGAATGTACTTGAGTTTC	Tilsala-Timisjarvi and Alatossava[42]
Streptococcus thermophilus	ST-R	TTTGGCCTTTCGACCTAAC	Tilsala-Timisjarvi and Alatossava[42]
Escherichia coli subgroup	F	GTTAATACCTTTGCTCATTGA	Malinen et al.[13]
Escherichia coli subgroup	R	ACCAGGGTATCTAATCCTGTT	Malinen et al.[13]
Bacteriodes group	Bac303F	GAAGGTCCCCCACATTG	Ramirez-Farias et al.[37]
Bacteriodes group	Bfr-Fmrev	CGCGACTTGGCTGGTTCAG	Ramirez-Farias et al.[37]
Clostridium.perfringens	F	ATGCAAGTCGAGCGA(G/T)G	Malinen et al.[13]
Clostridium.perfringens	R	TATGAGGTATTAATCT(C/T)CTTT	Malinen et al.[13]

Table 2. Baseline characteristics of patients
	Probiotics group (n = 25)	Placebo group (n = 24)
Age (years, mean ± SD)	45.9 ± 13.7	43.1 ± 15.1
Gender (male/female)	11/14	6/18
IBS subtype (IBS-D/IBS-C/IBS-M)	14/9/2	12/11/1
Abdominal pain (mean ± SD)	3.2 ± 1.7	3.1 ± 1.7
Abdominal discomfort (mean ± SD)	3.9 ± 1.6	3.5 ± 1.5
Abdominal bloating (mean ± SD)	4.2 ± 1.5	3.8 ± 2.3
Stool frequency/week (mean ± SD)	6.9 ± 4.7	6.3 ± 4.6
Stool form (BSFS) (mean ± SD)	4.6 ± 1.8	4.1 ± 1.8

There were no statistically significant differences between the two groups.
Abdominal pain, discomfort, and bloating were assessed on a numeric rating scale from 0 to 10, with symptoms increasing from 0 to 10.
BSFS, Bristol Stool Form Scale; IBS, irritable bowel syndrome; IBS-C, IBS with constipation; IBS-D, IBS with diarrhea; IBS-M, mixed-type IBS; n, number; SD, standard deviation.

Table 3. Comparison of IBS symptoms in baseline and week 4 (ITT analysis)
	Probiotics group (n = 25)		P value*	Placebo group (n = 24)		P value*
	Baseline	Week 4	P value*	Baseline	Week 4	P value*
Abdominal pain (mean ± SD)	3.2 ± 1.7	2.0 ± 1.9	< 0.01	3.1 ± 1.7	2.6 ± 1.4	0.13
Abdominal discomfort (mean ± SD)	3.9 ± 1.6	2.9 ± 2.2	< 0.01	3.5 ± 1.5	2.9 ± 1.3	0.17
Abdominal bloating (mean ± SD)	4.2 ± 1.5	3.0 ± 1.9	< 0.01	3.8 ± 2.3	3.1 ± 1.5	0.12
Stool Frequency/week (mean ± SD)	6.9 ± 4.7	5.7 ± 2.5	0.06	6.3 ± 4.6	6.1 ± 3.9	0.10
Stool Form (BSFS) (mean ± SD)	4.6 ± 1.8	4.4 ± 1.6	0.17	4.1 ± 1.8	3.8 ± 1.6	0.87

*P < 0.05 for comparison between baseline and week 4.
Abdominal pain, discomfort and bloating were assessed on a numeric rating scale from 0 to 10, with symptoms increasing from 0 to 10.
BSFS, Bristol Stool Form Scale; ITT, intention to treat; n, number; SD, standard deviation.

Table 4. The change of IBS symptoms between week 0 and week 4
	Change rates (%)		P value*
	Probiotics	Placebo	P value*
Abdominal pain (mean ± SD)	−37.1 ± 46.3	−9.2 ± 57.1	0.07
Abdominal discomfort (mean ± SD)	−28.7 ± 42.6	−17.8 ± 37.8	0.35
Abdominal bloating (mean ± SD)	−22.4 ± 49.0	−20.3 ± 30.5	0.86
Stool Frequency/week (mean ± SD)	−2.4 ± 35.0	32.6 ± 125.1	0.19
Stool Form (BSFS) (mean ± SD)	0.5 ± 30.4	−3.3 ± 33.2	0.68

*P < 0.05 for comparison between probiotics and placebo group.
Change rates (%) = (week 4 score − week 0 score)/week 0 score × 100.
BSFS, Bristol Stool Form Scale; IBS, irritable bowel syndrome; SD, standard deviation.

Table 5. Changes in fecal microbiota between baseline and week 4 in the multispecies probiotics and placebo groups
	Probiotics (n = 17)			Placebo (n = 17)
	Baseline	Week 4	P value*	Baseline	Week 4	P value*
Total bacteria	11.56 ± 0.32	11.64 ± 0.40	0.44	11.15 ± 0.74	11.45 ± 0.37	0.21
Bifidobacterium group	9.34 ± 0.69	9.37 ± 0.66	0.79	8.53 ± 1.25	8.90 ± 1.31	0.29
Bifidobacterium longum	8.81 ± 0.89	8.75 ± 0.73	0.53	8.15 ± 1.31	8.25 ± 1.48	0.72
Bifidobacterium bifidum	5.38 ± 1.11	5.28 ± 1.14	0.33	5.30 ± 1.22	5.36 ± 1.45	0.84
Bifidobacterium lactis	6.09 ± 1.23	7.57 ± 1.22	< 0.01	5.99 ± 0.52	6.54 ± 0.87	0.04
Lactobacillus group	8.38 ± 0.80	8.43 ± 0.82	0.57	7.76 ± 1.37	7.82 ± 0.99	0.88
Lactobacillus rhamnosus	2.80 ± 1.69	5.05 ± 1.43	< 0.01	2.82 ± 1.49	2.97 ± 1.17	0.22
Lactobacillus acidophilus	3.28 ± 0.77	3.65 ± 0.90	0.21	3.29 ± 1.12	2.93 ± 0.13	0.34
Streptococcus thermophilus	4.81 ± 0.87	5.35 ± 1.28	0.04	5.08 ± 1.47	5.20 ± 1.53	0.76
Escherichia coli subgroup	6.72 ± 1.06	7.11 ± 1.31	0.23	6.45 ± 1.10	6.41 ± 0.89	0.87
Bacteroides group	6.61 ± 1.18	7.06 ± 1.22	0.17	6.23 ± 1.06	6.87 ± 1.18	0.07
Clostridium perfringens	10.08 ± 0.18	10.02 ± 0.87	0.20	9.98 ± 1.18	10.02 ± 0.11	0.39

*P < 0.05 by paired t -test for the difference between baseline and week 4.
Values are mean ± standard deviation, and the unit of measurement is log₁₀ cells/gram in feces.