Effect of Multispecies Probiotics on Irritable Bowel Syndrome

A Randomized, Double-blind, Placebo-controlled Trial

Jun Sik Yoon; Won Sohn; Oh Young Lee; Sang Pyo Lee; Kang Nyeong Lee; Dae Won Jun; Hang Lak Lee; Byung Chul Yoon; Ho Soon Choi; Won-Seok Chung; Jae-Gu Seo

Disclosures

J Gastroenterol Hepatol. 2014;29(1):52-59.

Methods

Study Patients

Patients who were eligible for this study were aged 19–75 years and were diagnosed with IBS according to the Rome III diagnostic criteria. A colonoscopy or barium enema study had been performed in all patients within the previous 5 years. Exclusion criteria included a history of organic bowel disease (e.g. colon cancer, intestinal tuberculosis and inflammatory bowel disease), acute or chronic liver/kidney disease, significant allergic disorders (e.g. asthma), previous major abdominal surgery other than appendectomy, uncontrolled thyroid disease, and acute illness within the previous 2 weeks. No alcoholics, pregnant or nursing women were included. Patients who were using probiotics, prebiotics, synbiotics, antibiotics, corticosteroids, antidepressants, antihistamines, non-steroidal anti-inflammatory drugs, and other drugs that affect intestinal motility (e.g. laxatives, antidiarrheals, prokinetics, and antispasmotics) were excluded.

All enrolled participants received comprehensive information about this study, and informed consent was obtained before any study-related processes began.

Study Design and Procedures

The study was conducted at Hanyang University Hospital in Korea between March 2011 and August 2011, and was approved by the Clinical Research Ethics Committee of the Hanyang University Hospital of Korea (2010-04-009). After a 2-week run-in period, enrolled patients were randomly assigned to receive either one capsule (500 mg) of LacClean Gold-S (Cell Biotech, Co. Ltd, Gimpo, Korea; a multispecies probiotics) or one capsule (500 mg) of a placebo twice daily (total dosage 1000 mg/day) for 4 weeks (Fig. 1). The patients were instructed to take the study product between meals because the increased gastric pH is more favorable for the ingested bacteria. LacClean Gold-S is a capsule-form probiotics containing six species of live bacteria. The six strains of probiotics were Bifidobacterium bifidum (KCTC 12 199BP), Bifidobacterium lactis (KCTC 11 904BP), Bifidobacterium longum (KCTC 12 200BP), Lactobacillus acidophilus (KCTC 11 906BP), Lactobacillus rhamnosus (KCTC 12 202BP), and Streptococcus thermophilus (KCTC 11 870BP). A total of 5 × 10⁹ viable cells in a lyophilized powder form were included in each capsule and constituted 13.1% (w/w) of the total weight (500 mg/capsule). The amount of probiotics equally consisted in each of the six strains. The dose was determined based on previous studies where the daily doses were between 5 × 10⁷ and 3.6 × 10¹¹ colony forming units (CFUs)/day, and ≥ 5 × 10⁹ CFUs/day has been suggested.^[1] The placebo powder contained the same "other ingredients" as the active medication and maltodextrin instead of bacteria. OY Lee and KN Lee enrolled the patients for this study. Patients were allocated to the probiotics or placebo group using a computer-generated randomization schedule with a 1 : 1 allocation ratio. Dr. Jun generated the random allocation sequence, and no one but him knew the allocation sequence. The practice nurse gave a questionnaire and explained the protocol to the patients. The nurse did not know the allocation sequence and met the patients in regular sequence. The patient received the medication from the clinical pharmacist. No one could differentiate the two drugs without the sequence information. Stool samples for fecal microflora analysis were obtained immediately before the start of treatment and at the end of the 4 weeks of treatment. Fecal microbiota was analyzed only from patients who agreed to the stool sample collection.

(Enlarge Image)

Figure 1.

Consolidated Standards of Reporting Trials flowsheet. Probiotics: a probiotic mixture (total 5 × 10⁹ colony-forming unit) containing Bifidobacterium bifidum, B. lactis, B. longum, Lactobacillus acidophilus, L. rhamnosus, and Streptococcus thermophiles. Participants were randomly assigned to receive either one capsule of probiotics or one capsule of placebo twice daily for 4 weeks. ITT, intention to treat.

IBS symptoms were assessed by examiners and patients at baseline and week 4 using a questionnaire. Global relief of IBS symptoms, drug compliance, and adverse events were evaluated by a questionnaire after the 4 weeks of treatment.

Measurements

Efficacy Measurements The primary efficacy end-point was the proportion of patients who experienced global relief of IBS symptoms after the 4-week treatment. Efficacy was estimated by the response (yes or no) to the question: "Compared with your health before treatment started, have overall IBS symptoms improved during the past seven days?"

Secondary efficacy end-points were: (i) intensity of abdominal pain/discomfort and bloating, for which patients scored their worst symptoms over the previous 24 h on a numeric scale from 0 to 10; (ii) defecation frequency defined as the average number of episodes per week; (iii) stool consistency using the 7-point Bristol Stool Form Scale (BSFS); and (iv) alterations in the composition of fecal microflora as a result of treatment.

Compliance and Safety Assessments Drug compliance was defined as the ratio of number of drugs taken to the number of drugs prescribed. All adverse reactions were reported.

Fecal Samples Patients enrolled in the study provided fecal specimens at the beginning and end of the study. These were collected in sterile containers, brought to the laboratory in a frozen condition, and stored at −80°C until analysis.

Preparation of Genomic DNA From Reference Strains and Fecal Samples Bacterial genomic DNA from pure cultures or fecal samples was prepared using an AccuPrep Genomic DNA extraction kit (Bioneer, Daejeon, Korea). Genomic DNA was extracted from 1 mL of pure culture according to the manufacturer's instructions.

Real-time Quantitative Polymerase Chain Reaction Real-time quantitative polymerase chain reaction (PCR) was carried out using a LightCycler 480 (Roche, Germany), and the group and species-specific primers for PCR are listed in Table 1 . The primers were synthesized commercially by Bioneer, and their specificity was previously verified using DNA from closely or distantly related bacteria. Quantitative PCR was performed in 96-well plates in final volumes of 20 μL consisting of 1 μL of fecal DNA, 0.5 μL of primers (10 pmol each), 10 μL SYBR Green I master (Roche, Mannheim, Germany), and 8 μL of H₂O. PCR amplification involved: pre-incubation at 94°C for 4 min followed by 55 cycles of amplification (denaturation at 94°C for 15 s, primer annealing at 55°C for 15 s, and elongation at 72°C for 20 s). Melting curves were obtained by heating samples from 50 to 90°C at a rate of 5°C/s.

Statistical Analysis

The sample size for this study was calculated assuming a 40% difference in the primary end-point between two groups.^[12] From this assumption, we calculated that a total of 48 patients would have a statistical power of 80% and a two-sided α risk of 0.05. We planned to enroll 50 patients, as we expected some participants to dropout of the study.

Efficacy and safety were assessed by intention-to-treat (ITT) analysis. The ITT analysis included all participants who had taken any medication, and dropouts were regarded as non-responders. All significance tests were two-sided, and a P value of less than 0.05 was regarded as significant. All statistical analyses were performed using SPSS for Windows release 18.0 (SPSS, Inc., Chicago, IL, USA).

1 2 3 4

Next Section

Table 1. Oligonucleotides used for quantitative real-time polymerase chain reaction assays
Target groups or species	Primer names	Primer sequences (5'-3')	Reference
Total bacteria	341F	CCTACGGGAGGCAGCAG	Nakamura et al.[35]
Total bacteria	543R	ATTACCGCGGTGCTGG	Nakamura et al.[35]
Bifidobacterium group	F	TCGCGTC(C/T)GGTGTGAAAG	Rinttila et al.[36]
Bifidobacterium group	R	CCACATCCAGC(A/G)TCCAC	Rinttila et al.[36]
Bifidobacterium longum	BlonF	CAGTTGATCGCATGGTCTT	Ramirez-Farias et al.[37]
Bifidobacterium longum	BlonR	TACCCGTCGAAGCCAC	Ramirez-Farias et al.[37]
Bifidobacterium bifidum	BiBIF-1	CCACATGATCGCATGTGATTG	Matsuki et al.[38]
Bifidobacterium bifidum	BiBIF-2	CCGAAGGCTTGCTCCCAAA	Matsuki et al.[38]
Bifidobacterium lactis	BlactF	CCCTTTCCACGGGTCCC	Malinen et al.[39]
Bifidobacterium lactis	BlactR	AAGGGAAACCGTGTCTCCAC	Malinen et al.[39]
Lactobacillus group	F	AGCAGTAGGGAATCTTCCA	Rinttila et al.[36]
Lactobacillus group	R	CACCGCTACACATGGAG	Rinttila et al.[36]
Lactobacillus rhamnosus	LU-5	CTAGCGGGTGCGACTTTGTT	Song et al.[40]
Lactobacillus rhamnosus	RhaII	GCGATGCGAATTTCTATTAT	Song et al.[40]
Lactobacillus acidophilus	F-acid-IS	GAAAGAGCCCAAACCAAGTGATT	Haarman and Knol[41]
Lactobacillus acidophilus	R-acid-IS	CTTCCCAGATAATTCAACTATCGCTTA	Haarman and Knol[41]
Streptococcus thermophilus	ST-F	ACGGAATGTACTTGAGTTTC	Tilsala-Timisjarvi and Alatossava[42]
Streptococcus thermophilus	ST-R	TTTGGCCTTTCGACCTAAC	Tilsala-Timisjarvi and Alatossava[42]
Escherichia coli subgroup	F	GTTAATACCTTTGCTCATTGA	Malinen et al.[13]
Escherichia coli subgroup	R	ACCAGGGTATCTAATCCTGTT	Malinen et al.[13]
Bacteriodes group	Bac303F	GAAGGTCCCCCACATTG	Ramirez-Farias et al.[37]
Bacteriodes group	Bfr-Fmrev	CGCGACTTGGCTGGTTCAG	Ramirez-Farias et al.[37]
Clostridium.perfringens	F	ATGCAAGTCGAGCGA(G/T)G	Malinen et al.[13]
Clostridium.perfringens	R	TATGAGGTATTAATCT(C/T)CTTT	Malinen et al.[13]

Table 2. Baseline characteristics of patients
	Probiotics group (n = 25)	Placebo group (n = 24)
Age (years, mean ± SD)	45.9 ± 13.7	43.1 ± 15.1
Gender (male/female)	11/14	6/18
IBS subtype (IBS-D/IBS-C/IBS-M)	14/9/2	12/11/1
Abdominal pain (mean ± SD)	3.2 ± 1.7	3.1 ± 1.7
Abdominal discomfort (mean ± SD)	3.9 ± 1.6	3.5 ± 1.5
Abdominal bloating (mean ± SD)	4.2 ± 1.5	3.8 ± 2.3
Stool frequency/week (mean ± SD)	6.9 ± 4.7	6.3 ± 4.6
Stool form (BSFS) (mean ± SD)	4.6 ± 1.8	4.1 ± 1.8

There were no statistically significant differences between the two groups.
Abdominal pain, discomfort, and bloating were assessed on a numeric rating scale from 0 to 10, with symptoms increasing from 0 to 10.
BSFS, Bristol Stool Form Scale; IBS, irritable bowel syndrome; IBS-C, IBS with constipation; IBS-D, IBS with diarrhea; IBS-M, mixed-type IBS; n, number; SD, standard deviation.

Table 3. Comparison of IBS symptoms in baseline and week 4 (ITT analysis)
	Probiotics group (n = 25)		P value*	Placebo group (n = 24)		P value*
	Baseline	Week 4	P value*	Baseline	Week 4	P value*
Abdominal pain (mean ± SD)	3.2 ± 1.7	2.0 ± 1.9	< 0.01	3.1 ± 1.7	2.6 ± 1.4	0.13
Abdominal discomfort (mean ± SD)	3.9 ± 1.6	2.9 ± 2.2	< 0.01	3.5 ± 1.5	2.9 ± 1.3	0.17
Abdominal bloating (mean ± SD)	4.2 ± 1.5	3.0 ± 1.9	< 0.01	3.8 ± 2.3	3.1 ± 1.5	0.12
Stool Frequency/week (mean ± SD)	6.9 ± 4.7	5.7 ± 2.5	0.06	6.3 ± 4.6	6.1 ± 3.9	0.10
Stool Form (BSFS) (mean ± SD)	4.6 ± 1.8	4.4 ± 1.6	0.17	4.1 ± 1.8	3.8 ± 1.6	0.87

*P < 0.05 for comparison between baseline and week 4.
Abdominal pain, discomfort and bloating were assessed on a numeric rating scale from 0 to 10, with symptoms increasing from 0 to 10.
BSFS, Bristol Stool Form Scale; ITT, intention to treat; n, number; SD, standard deviation.

Table 4. The change of IBS symptoms between week 0 and week 4
	Change rates (%)		P value*
	Probiotics	Placebo	P value*
Abdominal pain (mean ± SD)	−37.1 ± 46.3	−9.2 ± 57.1	0.07
Abdominal discomfort (mean ± SD)	−28.7 ± 42.6	−17.8 ± 37.8	0.35
Abdominal bloating (mean ± SD)	−22.4 ± 49.0	−20.3 ± 30.5	0.86
Stool Frequency/week (mean ± SD)	−2.4 ± 35.0	32.6 ± 125.1	0.19
Stool Form (BSFS) (mean ± SD)	0.5 ± 30.4	−3.3 ± 33.2	0.68

*P < 0.05 for comparison between probiotics and placebo group.
Change rates (%) = (week 4 score − week 0 score)/week 0 score × 100.
BSFS, Bristol Stool Form Scale; IBS, irritable bowel syndrome; SD, standard deviation.

Table 5. Changes in fecal microbiota between baseline and week 4 in the multispecies probiotics and placebo groups
	Probiotics (n = 17)			Placebo (n = 17)
	Baseline	Week 4	P value*	Baseline	Week 4	P value*
Total bacteria	11.56 ± 0.32	11.64 ± 0.40	0.44	11.15 ± 0.74	11.45 ± 0.37	0.21
Bifidobacterium group	9.34 ± 0.69	9.37 ± 0.66	0.79	8.53 ± 1.25	8.90 ± 1.31	0.29
Bifidobacterium longum	8.81 ± 0.89	8.75 ± 0.73	0.53	8.15 ± 1.31	8.25 ± 1.48	0.72
Bifidobacterium bifidum	5.38 ± 1.11	5.28 ± 1.14	0.33	5.30 ± 1.22	5.36 ± 1.45	0.84
Bifidobacterium lactis	6.09 ± 1.23	7.57 ± 1.22	< 0.01	5.99 ± 0.52	6.54 ± 0.87	0.04
Lactobacillus group	8.38 ± 0.80	8.43 ± 0.82	0.57	7.76 ± 1.37	7.82 ± 0.99	0.88
Lactobacillus rhamnosus	2.80 ± 1.69	5.05 ± 1.43	< 0.01	2.82 ± 1.49	2.97 ± 1.17	0.22
Lactobacillus acidophilus	3.28 ± 0.77	3.65 ± 0.90	0.21	3.29 ± 1.12	2.93 ± 0.13	0.34
Streptococcus thermophilus	4.81 ± 0.87	5.35 ± 1.28	0.04	5.08 ± 1.47	5.20 ± 1.53	0.76
Escherichia coli subgroup	6.72 ± 1.06	7.11 ± 1.31	0.23	6.45 ± 1.10	6.41 ± 0.89	0.87
Bacteroides group	6.61 ± 1.18	7.06 ± 1.22	0.17	6.23 ± 1.06	6.87 ± 1.18	0.07
Clostridium perfringens	10.08 ± 0.18	10.02 ± 0.87	0.20	9.98 ± 1.18	10.02 ± 0.11	0.39

*P < 0.05 by paired t -test for the difference between baseline and week 4.
Values are mean ± standard deviation, and the unit of measurement is log₁₀ cells/gram in feces.