A Mill Based Instrument and Software System for Dissecting Slide-mounted Tissue That Provides Digital Guidance and Documentation

Nils Adey; Dale Emery; Derek Bosh; Steven Callahan; John Schreiner; Yang Chen; Ann Greig; Katherine Geiersbach; Robert Parry

Disclosures

BMC Clin Pathol. 2013;13(29) 

In This Article

Methods

Study Design, Setting, Participants, and Methods

The development of the mesodissection system followed an ISO 9001 compliant phase review process. The breadboard prototype instrument was developed at AvanSci Bio using a modified commercial milling machine and the consumables were constructed from common hardware components and pipet tips. The laboratory prototype instrument and software were developed at AvanSci Bio, ARUP Laboratories, and the Scientific Computing and Imaging (SCI) Institute at the University of Utah, using a combination of custom and off the shelf components. Production consumables were manufactured from custom injection molded components. The imaging software was written in C++ and interfaces with various hardware drivers. The initial laboratory prototype was presented in the exhibit hall of the Association of Molecular Pathology 2011 Annual Meeting to obtain potential user feedback. This feedback was used to refine the design of the current instrument.

Milling Instrument and xScisor Disposable

A new platform that uses milling technology to dissect tissue from slide-mounted tissue sections was developed (See Figures 1 and 2 for a detailed description). In the basic mill design, an object is attached to a table (stage) capable of controlled X and Y axis movement such that it can be driven against a fixed rotating cutting bit thereby shaping the object. However, as milling is typically not used for the purpose of collecting fragments, a plastic mill bit termed the xScisor was developed that simultaneously dispenses liquid, cuts tissue, and aspirates the tissue fragments from the surface of the glass slide (Figure 3). Low cost manufacturing methods were developed so the xScisor could be disposable to prevent sample cross-contamination. Because tissue is relatively soft compared to glass, a spring pressure controlled system was designed such that the xScisor blade rests on the slide surface with sufficient downward force to cut through the tissue but glides across the glass slide. Milling tissue from glass slides also provided the opportunity to place a digital microscope below the slide in order to view the process, direct the dissection, and generate digital documentation.

Figure 1.

The instrument. The mesodissection instrument is essentially a modified tissue milling machine comprised of a joystick-driven X-Y slide stage (A), a digital microscope (B) looking up through the slide adjustable from 5X to 60X total magnification, and a mill head (C) on a vertical axis mounted above the slide which lowers a spinning blade onto the slide surface to dissect the tissue. The blade is part of the disposable xScisor (D, described in detail in Figure 3), which simultaneously dispenses and aspirates fluid in a stage speed dependent rate in order to collect the tissue fragments. The user controls tissue dissection via a joystick while viewing the image from the digital microscope on a computer screen. Dissection can be guided using a digital outline that moves on the screen as the stage moves (See Figure 4). After the dissection is complete, the fragments are ejected into a small tube using the plunger control rod (E).

Figure 2.

Instrument architecture. The instrument architecture is separated into eight major modules based on analog controls. (1) The 2-axis hall-effect joystick controls stage movement, milling motor rotation, Z axis head assembly position, and aspirator activation. (2) The core of the imaging software is a modified DNVideo-X application from AnMo Electronics that utilizes discreet instrument outputs via a LabJack A/D converter. (3) A hollow shafted stepper motor rotates the xScisor at a speed controlled by a separate user controlled potentiometer. (4) The Z Axis head assembly position is controlled by a linear actuator with an integrated potentiometer to enable 3 positions: load/unload, ready and contact. Contact position involves the linear actuator lowering the head assembly onto a height adjustable spring such that the downward force on the xScisor blade is minimized. (5) The instrument controls the xScisor fluid flow rate by withdrawing the xScisor plunger using a second linear actuator driven by the sum of X and Y axis absolute voltage inputs from the joystick, and an optional joystick pushbutton pulse control. (6) These joystick derived voltages also control the X and Y axis stage position through gear DC motors connected to cogged belt drives to pairs of parallel leadscrew drives. Stage positional feedback is received from a pair of 10 turn precision analog potentiometers via the A/D convertor and a shared USB multiplex plug. (7) The digital microscope is a 1.3 megapixel Dino-Lite by AnMo electronics connected to the imaging software via a shared USB multiplex plug. (8) The electronics module consists of the main circuit board, two driver boards, and the LabJack A/D converter.

Figure 3.

The xScisor. The xScisor is essentially a modified syringe consisting of two reservoirs, one above and one below the plunger, and a cutting blade that contacts the slide surface. The xScisor assembly consists of four parts: an outer syringe barrel that mates with the collet on the instrument head assembly, an inner syringe barrel containing the cutting blade (A) at one end, a plunger, and a plug that seals the plunger to the outer syringe body. The width of the dissected area is controlled by the width of the cutting blade; xScisors have been produced with 100, 200, 400, 800, and 1200 micron blades. To use the xScisor, the upper reservoir is filled with milling solution by repeatedly depressing and withdrawing the plunger (Step 1), and then it is loaded into the collet. The collet rotates the entire xScisor as it lowers it onto the slide surface (Step 2). As the stage is moved, the tissue section is driven into the rotating cutting blade and the plunger is withdrawn at a stage speed dependent rate. This action simultaneously dispenses liquid from the outer ports (B), dissects the tissue, and aspirates the liquid along with the displaced tissue fragments into the inner ports (C). A fully loaded xScisor can dispense up to 70 μl of milling solution; it is not necessary to use it all, only what is required to dissect the desired area. When dissection is complete, the head assembly is raised and the aspirated liquid containing the tissue fragments is collected by depressing the plunger (Step 3). The recovered tissue fragments can be pelleted by centrifugation and excess milling solution removed with a pipet. The xScisor can be either reloaded or discarded to avoid sample cross contamination.

Software and Workflow

A software package was developed that was modeled after a typical manual slide-mounted tissue dissection workflow found in many molecular pathology labs (discussed above, see Figure 4 for a more detailed description). This software provides an interface to digitally indicate AOIs and save dissection reference images. Alternatively, the dissection reference image can be generated by digital scanning technology if it is saved in either .jpg, .png. or .tif file format. In the laboratory, the reference image was imported from the database, aligned to the magnified live view from a serial tissue section, the AOI transferred to overlay the live image and guide the dissection, and finally a digital report in PDF format was generated.

Figure 4.

Software and workflow. The following description illustrates how the mesodissection 2iD software can assist the slide-mounted tissue dissection workflow used in many molecular pathology labs. (1) A pathologist would save a digital picture of a slide-mounted tissue section and then while viewing the tissue section in a standard optical microscope, digitally indicate the AOIs, then save this reference image to a digital database. Alternatively, digital scanning technology can generate the digital image, the AOIs marked, and the reference image saved in either .jpg, .png, or .tif format. To perform the dissection, (2) the reference image is imported from the database and manipulated to match the live image from the slide stage (on right) of a serial tissue section (cut from the same tissue block). (3) The reference image and a picture of the live image are digitally overlaid and the position of the reference image is further manipulated to achieve microscopic alignment. (4) The AOI(s) are selected using color based recognition and transferred to overlay the live image. It is also possible to directly annotate the live image and determine the area of each AOI. (5) As the stage is moved, the digital AOIs move in unison with the live image such that the digital AOIs can be used to guide the dissection process. A gauge indicates remaining xScisor capacity. Proper AOI movement is based on proper calibration of stage movement with the magnification of the digital image. (6) After dissection, a digital report is generated that includes the reference image, pre and post dissected images with AOI, and notes of the process.

Tissue Samples Used in This Study

All human FFPE tissue sections used for the studies described here were derived from left over/unused normal regions of placenta, liver, bowel, kidney, and skin specimens from the Anatomic Pathology Gross Room at the University of Utah (Department of Pathology, School of Medicine). As these tissue sections were anonymized, they are exempt from IRB approval. All human tissues were processed using standard FFPE methods, and the resulting tissue blocks and the mouse-human fusion tissue blocks were sectioned at 5 micron thickness. The formalin perfused mouse liver and kidney tissues that were used to make the mouse-human fusion blocks were surplus tissues obtained from studies of the mouse olfactory system done at the University of Utah (Department of Physiology). All the mouse olfactory tissue sections were from the same source, but had been OCT embedded, and then frozen sectioned at 10 to 60 microns thickness. These olfactory tissue sections were surplus from the intended studies. For the studies described here, the OCT was replaced with paraffin as described below.

Resolution and Accuracy

Both resolution and accuracy were quantitated using Microsoft PowerPoint by visual examination of the post-dissection digital images including the scale bars generated by the mesodissection software. The accuracy values were determined by attempting to fill the difference between the intended and actual boundary with a line of relative width of 50, 100, or 250 microns (Figure 5A and B). Standard deviation was calculated using Microsoft Excel.

Figure 5.

Performance metrics. (A) Resolution is defined as the width of the minimum dissectible area (a circle) generated by touching the rotating blade to the tissue without transverse movement (known as a point dissection). Each value is from five tests on each of five xScisors where the xScisor was removed and replaced into the collet after every dissection. Ave. = average, SD = Standard Deviation. (B) Accuracy is defined as the average distance between the intended boundary (using the digital overlay) and the actual boundary of dissection. The values shown are the percent of the linear distance around the circumference of the actual dissection boundary that was within 50 and 100 microns, or outside of 250 microns of the intended dissection boundary. This experiment was performed on a total of 14 AOIs from three different human liver tissue section samples. For each sample, the total circumference of the AOIs is shown. (C) Efficiency is measured by DNA quantitation using Pico Green following Proteinase K digestion; both mesodissection and manual dissection appear to be near 100% by visualization. Paraffinized tissue is efficiently aspirated using mineral oil, somewhat less efficiently using buffers containing SDS (but visualization is better), and not efficiently held in suspension by many aqueous buffers. (D) Purity is the percent of the recovered sample that is from the dissected area (a measure of potential contamination from adjacent undissected tissue). Purity was determined by dissecting immediately adjacent human and mouse 5 micron liver tissue sections at the indicated distances from the intersection, then testing by multiplex PCR containing one human and one mouse amplicon, or single amplicon qPCR as described in Results.

Efficiency

Serially cut tissue sections were either deparaffinized with AvanSci Bio's mineral oil/alcohol system, or left paraffinized, then dissected by hand or using the mesodissection system. In order to dissect the same AOIs using both methods, the post manual dissected tissue sections were digitally outlined and used as guides for mesodissection. The resulting tissue samples were recovered in one of the following liquids: TE (10 mM Tris, 1 mM EDTA, pH 8.5), TE + 0.1% SDS, or light mineral oil, then subject to Proteinase K digestion by adding 5 μg of Proteinase K to the samples in TE and TE + SDS, or by adding 70 μl of TE with 5 μg proteinase K to the samples in mineral oil. Incubation was performed on the Thor (AvanSci Bio) programmable heater-shaker: 65°C 30 min 1500 rpm; 95°C 10 min 1500 rpm; 25°C 1 min 450 rpm. The samples were then centrifuged and assayed for genomic DNA concentration using PicoGreen according to the manufactures' protocol (Life Technologies) as a measure of total sample recovered.

Purity

To make the mouse-human fusion blocks, the formalin treated tissue samples described above were held in close proximity while casting in paraffin. The resulting 5 micron slide-mounted tissue sections were deparaffinized and dissected as indicated. The recovered tissue samples were Proteinase K digested as described above, then subject to both dual amplicon multiplex endpoint PCR with Taq Platinum using the recommended conditions (Life Technologies) and 2% agarose gel electrophoresis, or single amplicon qPCR using the Power SYBR Green master mix and the recommended conditions (Life Technologies). The PCR primer pair (amplicons) sequences (directed to either the mouse or human Cox1 mitochondrial genes) are: AGGGGACCCAATTCTCTACCA + CTCCGTGTAGGGTTGCAAGT (mouse) and TTCGGCGCATGAGCTGGAGTCC + AGTTGCCAAAGCCTCCGATT (human).

RNA Isolation, Reverse Transcription, and Quantitative PCR

The formalin perfused, OCT embedded, frozen sectioned, 10 to 60 microns thick mouse olfactory tissue sections that were obtained for this study were relatively poorly adhered to the slides surface and tended to be dislodged rather than cut by the spinning xScisor blade. Therefore, the tissue sections were gently rinsed in 0.1X PBS to remove the OCT, dipped in molten paraffin for 5 minutes, then the excess paraffin allowed to drain by standing the slide on edge at 70°C for 5 minutes. These tissue sections were milled using 70 μl per sample of light mineral oil, then 70 μl of TE, pH 8.5 containing 5 μg of protease K was added and the tubes mixed. Protease K digestion was carried out using the Thor heater-shaker at 60°C 30 min 1500 rpm; 82°C 15 min 1500 rpm; 25°C 1 min 450 rpm. The overlaying mineral oil was removed using Wicking Strips (AvanSci Bio), then 90 μl PKD buffer (Qiagen) was added to achieve 160 μl total volume. Next, 16 μl of DNase booster buffer and 10 μl of DNase I (Qiagen) were added to each tube, the tubes incubated at room temperature for 15 minutes and the RNA isolated as described in the RNeasy FFPE kit (Qiagen). The manual dissected material was processed using the limonene deparaffinization protocol described in the RNeasy FFPE kit. cDNA was generated using the Applied BioSystems High Capacity Reverse Transcription kit and Quantitative PCR was performed using Applied BioSystems Power SYBR Green reagent as described in the manufacturer's protocol. The primers pairs used in the qPCR were GATGACTGAGTACCTGAACCG + CAGAGACAGCCAGGAGAAATC (mouse Bcl-2 cDNA) and GCCCTCCGTATCTTACTTCAAG + GCGGTCCAGGTAGTTCATG (mouse Cyclin D1 cDNA).

FISH

Slide-mounted tissue sections were deparaffinized using d-limonene or AvanSci Bio's mineral oil/alcohol system, then mesodissected using TE plus 0.1% Tween-20 as the milling solution. Recovered tissue fragments were centrifuged for 2 minutes, the majority of the supernatant discarded, the fragments resuspended, and 2 μl aliquots were spotted onto Fisher Scientific Capillary Gap plus slides (130 micron) and baked at 65°C for 2 hours. These slides were then subject to tissue FISH processing using the Kreatech recommended FFPE Tissue FISH protocol.

Comments

3090D553-9492-4563-8681-AD288FA52ACE

processing....