MicroRNA Let-7a Suppresses Breast Cancer Cell Migration and Invasion Through Downregulation of C-C Chemokine Receptor Type 7

Seok-Jun Kim; Ji-Young Shin; Kang-Duck Lee; Young-Ki Bae; Ki W Sung; Seok J Nam; Kyung-Hee Chun

Disclosures

Breast Cancer Res. 2012;14(1):R14 

In This Article

Materials and Methods

Tissues

Tissue samples were obtained at biopsy from 15 breast cancer patients (five infiltrating ductal cancer, one metaplastic cancer matrix-producing type, seven invasive ductal cancer, one infiltrating cribriform cancer, and one atypical medullary cancer) and their normal counterparts at Samsung Medical Center in Korea. The protocol for the study was approved by the institutional review board (IRB) at Samsung Medical Center.[1] All participants provided written informed consent and the use of tissues for comprehensive experiments of breast cancer informed consent. Immediately after biopsy, the tissue samples were frozen in liquid nitrogen and stored at −70°C until use.

Cell Culture and Transfection

Human breast cancer cell lines, SK-BR-3, MDA-MB-231, MCF-7, Hs-578T, T47D, ZR-75-1, and JIMT-1 were obtained from the ATCC and maintained in RPMI 1640 and Dulbecco modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% antibiotics (Invitrogen, San Diego, CA, USA). The dsRNA used in transfection experiments as a scrambled siRNA (scRNA) was 5'-UCACAACCUCCUAGAAAGAGUAGA-3', synthetic let-7a: 5'-UGAGGUAGUAGGUUGUAUAGUU-3', CCL21 siRNA: 5'- GUACAGCCAAAGGAAGAUUUU-3', and CCR7 siRNA: 5'- GCTGGTCGTGTTGA CCTAT-3'. All of these were synthesized by Genolution Company in Korea. In addition, commercial anti-let-7a oligonucleotide was purchased from Panagene in Korea. The dsRNA was transfected into MDA-MB-231 and MCF-7 cell lines by using Lipofectamine RNAiMAX and Lipofectamine 2000 reagents (Invitrogen), according to the reagent manufacturer's instructions. The MDA-MB-231 and MCF-7 cell lines were harvested 2 days after transfection, and various analyses were performed.

RNA Isolation and Reverse Transcription Polymerase Chain Reaction

Total RNA was isolated from seven breast cancer cell lines and 10 breast cancer patients' tissues, respectively, by using TRIzol reagent (Invitrogen) and following the manufacturer's instructions. Reverse transcription polymerase chain reaction (RT-PCR) was performed by using the Reverse Transcription System (Promega, Madison, WI, USA). PCR experiments were performed after reverse transcription. The primers for β-actin were 5'-AGCCTCGCCTTTGCCGA-3' and 5'-CTGGTGCCTGGGGCG-3'; for CCR7, 5'-GATGCGATGCTCTCTCATCA-3' and 5'-TGTAGGGCAGCTGGAAGACT-3', and for CCL21, 5'-GCCTTGCCACACTCTTTCTC-3' and 5'-CAAGGAAGAGGTGGGGTGTA-3'. The PCR was performed by using Ex-Taq (TaKaRa) methods.

microRNA Real-time RT-PCR

A TaqMan One-step RT-PCR Master Mix Reagents kit, purchased from Applied Biosystems (ABI, Foster City, CA, USA) was used. Amplification and detection were performed by using a 7900HT Sequence Detection System (ABI) with 40 cycles of denaturation at 95°C (15 seconds) and annealing/extension at 60°C (60 seconds). This was preceded by reverse transcription at 50°C for 30 minutes and denaturation at 95°C for 10 minutes. To quantitate mature miRNA, TaqMan MicroRNA Assays kits were purchased from ABI to detect let-7a and a control miRNA (RNU6B) (ABI). The protocol is two steps, requiring reverse transcription with an miRNA-specific primer, followed by real-time PCR with TaqMan probes (ABI).

Western Blot Analysis

Protein was extracted from seven breast cancer cell lines and 10 breast cancer patient tissue samples by using RIPA buffer (Biosesang), including a protease inhibitor cocktail (Sigma) and TRIzol reagent (Invitrogen), according to the manufacturers' instructions. Next, Western blotting was performed by using anti-β-actin, anti-CKR7 (CCR7), anti-IGF-1R (Santa Cruz) anti-c-Myc, and anti-CDK4 (Cell Signaling) antibodies. The signals were detected with an ECL kit (Amersham) by following the manufacturer's instructions.

Trans-filter Migration and Invasion Assays

Trans-filter migration and invasion assays were performed on MDA-MB-231 and MCF-7 cell lines in serum-free DMEM with 8.0-μm pore inserts on a 24-well Transwell (Corning Costar, Lowell, MA, USA). The cell lines were transfected with synthetic let-7a, CCR7 siRNA, anti-let-7a, and scRNA for 1 day and then transferred to the upper chamber of the Transwell coated with 0.5 mg/ml collagen type I (BD Bioscience) and a 1:15 dilution of Matrigel (BD Bioscience). Migrating and invading cells were quantified after H&E staining. Migration and invasion assays were performed after transfection, as previously described.[18]

The Luciferase Reporter Plasmid Constructions

The luciferase reporter constructs were generated by introducing the CCR7 3'UTR carrying a let-7a binding site into the pGL3 control vector (Promega). First, the CCR7 3'UTR wild-type (WT) sequence was amplified with PCR by using primers WT-FW (including Xba I restriction enzyme sites) 5'-CTAGTCTAGAGCGACTCTTCTGCCTGG-3' and WT-BW 5'- CTAGTCTAGAGCCATTTACCAAAGACTTTTTTTTTC-3' with MDA-MB-231 cDNA as a template, followed by PCR for the CCR7 3'UTR mutant type (MUT) sequence by using primers MUT-FW (including Xba I restriction enzyme sites) 5'-CTAGTCTAGAAACAGAGGCTAT TGTCCCC-3' and MUT-BW 5'- CTAGTCTAGAGCCATTTACCAAAGACTTTTTTTTTC -3' with MDA-MB-231 cDNA as a template. PCR was performed with pfu polymerase (SUN gene, Korea) methods. The resulting PCR fragments were cloned into the pGL3 vector by using Xba I restriction enzyme sites, creating the pGL3 CCR7 3'UTR WT and pGL3 CCR7 3'UTR MUT constructs. All PCR products were verified by DNA sequencing.

Luciferase Assay

Luciferase assays were performed in HEK-293 cells. HEK-293 cells were transfected with each of the plasmids (empty vector (EV), CCR7 3'UTR WT and CCR7 3'UTR MUT, as a let-7a binding site) together with synthetic let-7a oligonucleotides and negative control RNA in six-well plates. Forty-eight hours after transfection, the cells were harvested and lysed. Luciferase assays were performed on the lysates by using a luciferase assay kit (Promega). The luciferase activity was normalized to β-galactosidase.

Northern Blot Analysis

Total RNA was isolated from human breast cancer cell lines by using TRIzol reagent (Invitrogen). RNA samples (15 μg each) were loaded on 15% acrylamide denaturing (urea) gels and then transferred onto nylon membranes. The hybridization with [γ-32P] ATP was performed at 37°C in a prehybridization solution (Clonetech) overnight. The membrane was washed at 37°C twice with 1 × SSC [0.3 M trisodium citrate and 3.0 M sodium chloride in high-purity dH2O, pH 7.0]. The oligonucleotide probes used were 5'-AACTATACAA CCTACTACCTCA-3' with a sequence complementary to the mature let-7a RNA. An oligonucleotide complementary to the U6 RNA, 5'-GCAGGGGCCATGCTAATCTTCTC TGTATCG-3', was used to normalize expression levels. Blots were stripped by boiling in 0.1% aqueous SDS in DEPC water for 1 minute and reprobed several times. As the loading control, tRNA stained with ethidium bromide was used.

Cell-proliferation Assay

Cell proliferation was measured with the MTT assay. MDA-MB-231 and MCF-7 cells were plated in 96-well culture plates (3 × 103 per well), followed by transfection of synthetic let-7a, CCR7 siRNA, anti-let-7a, and scRNA. After 48 hours of incubation, the MTT (0.5 mg/ml) (Sigma-Aldrich) was subsequently added to each well (200 μl/well). After 4 hours of additional incubation, the MTT solution was discarded; and 200 μl of DMSO (Amresco) was added, and the plate was shaken gently. The absorbance was measured on an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 570 nm.

Statistical Analysis

Data are presented as mean ± SD from at least four to five images obtained from three independent experiments by using a microscope (×200), unless otherwise indicated. Statistical analysis was performed with one-way ANOVA by using Prism software and the Student t test for comparison between groups. Data were considered significant if P < 0.05.

Comments

3090D553-9492-4563-8681-AD288FA52ACE
Comments on Medscape are moderated and should be professional in tone and on topic. You must declare any conflicts of interest related to your comments and responses. Please see our Commenting Guide for further information. We reserve the right to remove posts at our sole discretion.
Post as:

processing....