NPHS2 Variation in Focal and Segmental Glomerulosclerosis

Stephen J Tonna; Alexander Needham; Krishna Polu; Andrea Uscinski; Gerald B Appel; Ronald J Falk; Avi Katz; Salah Al-Waheeb; Bernard S Kaplan; George Jerums; Judy Savige; Jennifer Harmon; Kang Zhang; Gary C Curhan; Martin R Pollak

Disclosures

BMC Nephrology 

In This Article

Methods

Three hundred and seventy-one unrelated individuals diagnosed with FSGS were studied. Of these, 122 (33%) had at least one affected relative, while the remaining 249 (67%) were sporadic cases without a family history. Most of these samples were ascertained after referral by a nephrologist caring for the subject and one or more family members.

Two hundred (54%) of the subjects were Caucasian. The remaining 171 were either African American (n = 68, 18.2%), Hispanic (n = 26, 7%), Asian (n = 6, 1.6%), American Indian (n = 1, 0.2%) or of unreported ethnicity (n = 70, 19%). Families and sporadic cases with radiologic, clinical or histopathologic findings consistent with secondary forms of FSGS were excluded from the analysis. The median age of onset of disease in the subjects studied was 25 years (range 0.25-to-65 years of age). The median age of onset of FSGS in the familial cases was 16 years (range 1.20-to 50 years of age), while that of sporadic patients was 26 years (range 1.25-to-69 years).

We genotyped samples from women enrolled in the Nurses' Health Study I or II.[11] The Nurses' Health Study (NHS) samples are large prospective cohorts of female registered nurses. We also genotyped 1988 samples from three distinct study groups, the University of Utah diabetes study, the Genetics of Kidney Disease in Diabetes study (GoKinD), and Australian endocrine diabetics. University of Utah diabetes study: n = 280; 41 type 1 diabetic individuals and 239 with type 2 diabetes. Twenty patients (49%) with type 1 diabetes and 89 patients (37%) with type 2 diabetes had end-stage renal disease. Diabetic patients without end-stage renal disease were used as controls (21/41, 51% of type 1 diabetics; 150/239, 63% of type 2 diabetics). Median age of type 2 diabetic cases was 22 years, and controls with type 2 diabetes was 19 years. The median age of the type 1 diabetic cases and controls was not available). Genetics of Kidney Disease in Diabetes (GoKinD) study group: n = 1,279; 455 "case" samples have end-stage renal disease and 824 who do not have end-stage renal disease were used as "control" subjects. All GoKinD subjects have long-standing (10+ years) of type 1 diabetes. Median age of the cases was 44, and median age of controls was 40 years. Australian endocrine diabetes group: n = 429; 67 type 1 diabetic subjects and 362 with type 2 disease. Fifty-one of the type 1 diabetics had an urinary albumin excretion rate (AER) <20 μg/min, 10 had an AER between 20 μg/min and 200 μg/min, and the remaining 6 had an AER >20 μg/min). Two hundred and twenty-eight of the type 2 diabetics had an AER<20 μg/min, 83 had an AER between 20 μg/min and 200 μg/min, and the remaining 46 had an AER >20 μg/min. The median age of the type 1 microalbuminurics was 55 years, that of macroalbuminurics was also 55 years and normoalbuminurics was 53 years. The median age of the type 2 diabetics with microalbuminuria was 67 years, that of macroalbuminurics was 68 years and normoalbuminurics was 70 years.

Studies were performed in accordance with human subject protocols approved by the human research committees at each of the institutions.

NPHS2 Sequence Analysis. Genomic DNA was extracted from peripheral blood cells using the QIAmp DNA blood kit (QIAGEN Inc., Valencia, California, USA). Total genomic DNA (20–25 ng) was amplified using primers designed from the analysis of the available genomic sequence (Homo sapiens chromosome 1 BAC clone RP11-545A16, GeneBank accession number AL160286). An ABI 3730xl DNA analyzer was used for sequence analysis. Primers used for sequence analysis are available on request.

Novel variants that were not identified in previous studies of NPHS2 were studied for their frequency in a cohort of 362 non-diseased Caucasian HapMap CEPH control alleles and, when possible, co-segregation with disease in the respective families. In both instances, genotyping was performed using MALDI-TOF mass spectroscopy based SNP genotyping (Sequenom) at the Harvard Partners Genotyping Facility. Large control cohorts with no known kidney disease from other ethnic groups were not necessary in this study, as most of the patients in whom we identified novel mutations were Caucasian. Only one sample was non-Caucasian, and control samples from this ethnic group (Sri-Lanken) was not available.

One thousand nine hundred and eighty eight diabetic samples from 3 distinct study groups with either type 1 or type 2 diabetes were genotyped for the p.R229Q variant using either an p.R229Q TaqMan allelic discrimination assay, the MALDI-TOF mass spectroscopy Sequenom based SNP genotyping at the Harvard Partners Genotyping Facility or Cla I digestion of exon 5 NPHS2 amplicons.

We designed a TaqMan allelic discrimination assay that used a specific fluorescent, dye-labeled probe for both the wild type (G755G) and mutant p.R229Q (G755A) alleles. The sequences of the probes and primers were: wildtype probe (Allele G) AGGGATCGATGTGCT-VIC dye at the 5' end and MGB quencher at the 3' end, mutant probe (Allele A) TGAGGGATTGATGTGC-FAM at the 5' end and MGB quencher at the 3' end, forward primer AATTCCTTGTGCAAACCACTATGAA, reverse primer CGATGCTCTTCCTCTCTAGAAGAATTT. A 25 μL reaction was prepared for each sample analyzed, containing 12.5 μL of TaqMan Universal PCR Master Mix containing AmpliTaq Gold DNA polymerase and other reagents (Applied Biosystems, Foster City, CA, USA), 9.5 μL of DNase, RNase and Protease free Molecular grade water (Cellgro, Lawrence, KS, USA), 0.5 μL of 100 pmole concentration of forward and reverse primers (Applied Biosystems, Foster City, CA, USA), 0.0625 μL of 100 uM concentration of Allele G and Allele A Taqman MGB probes (Applied Biosystems, Foster City, CA, USA) and 2.5 μL of 25 ng total genomic DNA or p.R229Q plasmid DNA. Controls for this assay consisted of non-template controls (NTC), 3 FSGS patients and 1 sibling from each of these subjects, that either have or were not shown to have p.R229Q in a heterozygous state from prior studies respectively[6]), and an p.R229Q plasmid (homozygous control). Genotyping was performed in an Applied Biosystems 7300/7500 Real-Time PCR machine (Applied Biosystems, Foster City, CA, USA).

All 429 samples from the Australian endocrine diabetics were examined for p.R229Q using Cla1 digestion[6] and further verified using direct sequencing performed with the ABI Prism Big Dye Terminator Cycle Sequencing-ready reaction kit (PE Applied Biosystems) by the Australian Genome Research Facility using a Perkin-Elmer 377 automated sequencer.

Samples from either the Nurses' Health Study I or II were genotyped for p.A242V or p.R229Q using a MALDI-TOF mass spectroscopy Sequenom based SNP genotyping assay developed and performed at the Harvard Partners Genotyping Facility. Four Caucasian controls (CEPH) samples from the international HapMap project without at least one p.R229Q or p.A242V allele were genotyped at the same time as the patient samples, and these were consistently negative for both the c.686G>A and c.725C>T of p.R229Q and p.A242V respectively. These variants do not exist in public SNP databases nor are they present on current Affymetrix genotyping SNP panels to our knowledge.

The frequency distributions of alleles was assessed using StatView for Windows, version 5.0 and SAS version 9.0.

processing....