Coronavirus HKU1 Infection in the United States

Frank Esper; Carla Weibel; David Ferguson; Marie L. Landry; Jeffrey S. Kahn

Disclosures

Emerging Infectious Diseases. 2006;12(4) 

In This Article

Methods

Clinical Specimens

Nasopharyngeal swabs and aspirates submitted to the clinical virology laboratory at Yale–New Haven Hospital from December 16, 2001, to December 15, 2002, for respiratory virus diagnosis were initially tested for RSV, parainfluenza viruses (types 1–3), influenza A and B viruses, and adenovirus by direct immunofluorescence assay. Respiratory specimens were screened for human metapneumovirus[16] and HCoV-NH[10] by RT-PCR. Specimens originated from the emergency department, inpatient wards, intensive care units, and the hospital-affiliated primary care outpatient clinic and were submitted at the discretion of the medical teams. Clinical specimens from children <5 years of age that tested negative by direct immunofluorescence assay were tested for HCoV-HKU1 as described below. Collection of specimens and clinical data was approved by the Yale University Human Investigation Committee and compliant with Health Insurance Portability and Accountability Act regulations.

RT-PCR Screening

RNA from each respiratory specimen was extracted with the QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA, USA), according to the manufacturer's protocol. Random hexamer primers synthesized by the oligonucleotide laboratory, Department of Pathology, Yale University School of Medicine, were used to create a cDNA library for each specimen. Reverse transcription reactions were performed with MuMLV RT (New England Biolabs, Beverly, MA, USA), according to the manufacturer's specifications. Each cDNA was subsequently screened for the presence of HCoV-HKU1 by polymerase chain reaction with HotStar Taq polymerase (Qiagen), according to the manufacturer's specification. Primers used to screen respiratory specimens were identical to those described by Woo et al..[14] The forward primer, 5' GGTTGGGATTATCCTAAATGTGA, and reverse primer, 5' CCATCATCACTCAAAATCATCATA, produce an amplicon that corresponds to nucleotides 15409–15848 of the HCoV-HKU1 replicase 1B gene (GenBank accession no. AY597011) and yields an amplicon of 439 bp. Amplification cycles were as follows: 95°C for 15 min; followed by 40 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min; and completed with a final extension cycle of 72°C for 10 min. Each set of reverse transcription and polymerase chain reactions contained appropriate negative controls. Sequencing was performed on an Applied Biosystems 3730 XL DNA Analyzer (Foster City, CA, USA) at the W.M. Keck Biotechnology Resource Lab, Yale University School of Medicine.

Clinical Data

Medical records of all HCoV-HKU1–positive children were reviewed. Demographic data, history of illness, and results of clinical examination and laboratory studies were recorded on a standard collection form. The Yale University Human Investigation Committee approved collection of specimens and clinical data.

Comments

3090D553-9492-4563-8681-AD288FA52ACE
Comments on Medscape are moderated and should be professional in tone and on topic. You must declare any conflicts of interest related to your comments and responses. Please see our Commenting Guide for further information. We reserve the right to remove posts at our sole discretion.
Post as:

processing....