Molecular Epidemiology of Human Enterovirus 71 Strains and Recent Outbreaks in the Asia-Pacific Region: Comparative Analysis of the VP1 and VP4 Genes

Mary Jane Cardosa, David Perera, Betty A. Brown, Doosung Cheon, Hung Ming Chan, Kwai Peng Chan, Haewol Cho, Peter McMinn

Emerging Infectious Diseases. 2003;9(4) 

In This Article

Materials and Methods

All viruses used in this study were propagated in rhabdomyosarcoma cells before extraction of RNA. Thirty-nine representative HEV71 isolates from recent years in Sarawak, Singapore, Perth, and Korea, as well as 16 strains isolated in the United States from1972 to 1995, were propagated in rhabdomyosarcoma cells and subjected to nucleotide sequence analysis (see below). These strains were used to generate 12 new VP1 gene sequences and 55 new VP4 gene sequences ( Table 1 , online only).

RNA was extracted from infected rhabdomyosarcoma cell supernatants by using the High Pure viral nucleic acid kit (Roche Diagnostics GmbH, Mannheim, Germany). RT-PCR was performed as described,[22] except that the annealing temperature for amplification of the VP4 gene was 50°C. Primer pairs 159/162 and 161/NP1A[24] were used for VP1 amplification of nucleotides (nt) 2385 to 2850 relative to BrCr; for VP4 amplification, the primers VP2-REV (5'TTCCAATACCACCCCTTGGATGA 3') and EVP-2[19] were used to amplify nt 449 to 1192 relative to BrCr.

PCR products were purified from gels with the QIAquick gel extraction kit (QIAGEN Inc, Valencia, CA). Cycle sequencing was achieved with the primers 159/162 and 161/NP1A for VP1 and EVP-4[15] and VP2-REV for VP4 by using the Big Dye Terminator Cycle Sequencing kit version 2.0 (Applied Biosystems, Foster City, CA). All sequences were determined for both strands by using the ABI377 automated DNA sequencer (Applied Biosystems).

The VP4 gene sequences of another 78 HEV71 strains obtained from GenBank ( Table 2 , online only) were included in this analysis, allowing the generation of dendrograms containing 128 HEV71 strains isolated from 1970 to 2002. These strains were isolated in the United States, Japan, Taiwan, Malaysia, Singapore, China, Bulgaria, Hungary, and the United Kingdom. In addition, 33 complete and 9 near-complete VP1 gene sequences of HEV71 strains retrieved from GenBank and used in this study are listed in ( Table 2 , online only.

Alignment of the VP1 and VP4 gene sequences was undertaken by using the ClustalW program.[25] Dendrograms were constructed by using the neighbor-joining method with PHYLIP, version 3.5[26] and drawn using TreeView.[27] Bootstrap analysis with 1,000 pseudoreplicates was performed by using the program Seqboot.[28] The CA16 strain G10[29] was used as an outgroup for phylogenetic analysis of the VP4 sequence data, and the HEV71 prototype strain BrCr-CA-70[30] was used as an outgroup for analysis of the VP1 sequence data. Historically Brown and co-workers[21] described genogroups as lineages of HEV71 distinguished by differing at least 15% in the VP1 gene. In this study we maintained the genogroups originally described and designated subgenogroups to aid in discussing evolving progeny viruses.

Comments

3090D553-9492-4563-8681-AD288FA52ACE
Comments on Medscape are moderated and should be professional in tone and on topic. You must declare any conflicts of interest related to your comments and responses. Please see our Commenting Guide for further information. We reserve the right to remove posts at our sole discretion.
Post as:

processing....