Which genes are associated with Peutz-Jeghers syndrome (PJS)?

Updated: Oct 11, 2018
  • Author: Buu Anh T To, MD; Chief Editor: Praveen K Roy, MD, AGAF  more...
  • Print
Answer

Answer

The cause of Peutz-Jeghers syndrome (PJS) in most cases (>90%) appears to be a germline mutation of the STK11/LKB1 (serine/threonine kinase 11) tumor suppressor gene, [2, 116]  located on chromosome 19p13. [1, 22]

STK11 is a tumor suppressor gene, in that its overexpression can induce a growth arrest of a cell at the G1 phase of the cell cycle and that somatic inactivation of the unaffected allele of STK11 is often observed in polyps and cancers from patients with Peutz-Jeghers syndrome.

STK11/LKB1 encodes a 433 amino acid ubiquitously expressed protein with a central catalytic domain and regulatory N- and C-terminal domains. The biologic function of LKB1 includes the regulation of downstream kinases, including adenosine monophosphate–activated protein kinase (AMPK) and the related kinases (microtube affinity-regulating kinase [MARK] 1 through MARK4 and brain-specific kinase/synapses of the amphid-defective kinase [Brsk/SAD]), which are involved in cellular metabolic regulation–stress response and cellular polarity, the latter through tubulin stabilization, tight junction formation, and E-cadherin localization. See the figure below.

This diagram demonstrates the role of STK11/LKB1 i This diagram demonstrates the role of STK11/LKB1 in neoplasia: regulation of cell polarity and metabolism. ACC = acetyl-CoA carboxylase; AMP/ATP = adenosine monophosphate/adenosine triphosphate; AMPK = AMP-activated protein kinase; CREB = CRE-binding protein; FAS = fatty acid synthase; MAPs = microtubule associated proteins; MARK = microtube affinity-regulating kinases; MO25 = calcium-binding protein 39; MRLC = myosin regulatory light chain; mTOR = mammalian target of rapamycin; SAD = synapses of the amphid-defective kinase; SIK = salt-induced kinase; STRAD = STE20-related kinase adaptor; TAU = tau protein; TORC = TOR complex; TSC 1/2 = tuberous sclerosis proteins 1 and 2.

There is evidence of interaction between the LKB1 pathway along with other tumor suppressor pathways p53 [117] and phosphatase and tensin homologue (PTEN). Abrogation of LKB1 function results in polyposis along with loss of heterozygosity, probably a separate process, resulting in tumorigenesis.

Penetrance of the gene mutation is variable, resulting in a spectrum of phenotypic manifestations among patients with Peutz-Jeghers syndrome (eg, inconsistent number, localization of polyps, differing presentation of the macules) and allowing for a variable presentation of cancer. [11, 23, 24, 25, 26, 27, 28, 29, 30]

Data on the impact of the LKB1 mutation type and localization on disease expression are conflicting. It is believed that truncating variants in STK11 predispose to a more severe phenotype, and phenotype severity is based on an earlier onset of gastrointestinal pathology arising from the polyps (eg, intussesception, earlier onset malignancy). [1] However, a consensus does not yet exist regarding phenotype severity based on variant location.

Schumacher and colleagues reported a higher risk of malignancy with missense mutations involving the C-terminus or exons encoding for protein domains involved in substrate recognition. [31, 32, 33]  Another report described a worse prognosis with greater polyp burden and higher risk of malignancy in individuals harboring a truncating mutation of LKB, [34]  whereas a different group failed to correlate the risk of (polyp-associated) intussusception with mutational characteristics. Overall opinion is divided on the usefulness of genotype-phenotype correlations in Peutz-Jeghers syndrome, and they are not, at present, routinely used in defining prognosis and management of the disease.

Mutation in the MYH11 gene may be implicated in a minority of patients without the LKB1 gene mutation. Hyperactivation of mammalian target of rapamycin (mTOR) signaling has also been associated with Peutz-Jeghers syndrome. [30]

Other genes may also play a role in Peutz-Jeghers syndrome, such as those that encode for the MARK protein, homologues of the Par 1 polarity protein that associates with LKB1. However, de Leng et al performed direct sequencing and probe amplification in 23 families with Peutz-Jeghers syndrome and were unable to identify any mutations in the MARK genes. [28]  This again supports the evidence that LKB1 defects remain the major cause of Peutz-Jeghers syndrome and, although other mechanisms are involved, they remain to be elucidated. [29]

An interesting study by Tobi et al demonstrated that Adnab-9, a premalignant marker found in Paneth cells, was more common in patients with Peutz-Jeghers syndrome. [35]  The authors evaluated 8 patients with Peutz-Jeghers syndrome, 8 patients with juvenile polyposis, and 36 hyperplastic polyp sections (as control subjects). The investigators found that 89% of Peutz-Jeghers syndrome polyps were labeled with Adnab-9, compared with 88% of familial juvenile polyposis sections and 11% of hyperplastic polyps. [35]  This study suggested Adnab-9 labeling may identify polyps at higher risk of malignant degeneration.

Mehenni et al, reporting on the molecular and clinical characteristics of 46 families with Peutz-Jeghers syndrome, demonstrated an increase in the mutational spectrum of LKB1/STK11 allelic variants worldwide. They suggested that this new information would be helpful for clinical diagnosis and genetic counseling. [25]

Novel de novo germline mutations associated with Peutz-Jeghers syndrome and STK11 continue to be discovered. Using Sanger sequencing,  Zhao et al identified a c.962_963delCC mutation in exon 8 in a Chinese patient with isolated Peutz-Jeghers syndrome who died of colon cancer. [36]  This mutation caused a frameshift mutation and a premature termination at codon 358. Neither of the patient's parents nor 50 control subjects had this mutation. Similarly, in a separate report, the same investigators identified a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3 of STK11 that caused a change of 13 codons and a truncating protein (p.S142SfsX13) in another Chinese patient. None of this patient's healthy family members nor 100 control subjects exhibited the mutation. [37]

Chiang and Chen used genomic DNA to amplify and analyze the entire sequence of STK11 in 15 Taiwanese patients with Peutz-Jeghers syndrome from 11 unrelated families and found 5 novel mutations in 8 families (exon 6, c.843 ins G; exon 8, c.2065 delete A; exon 8, c.G923A, nonsense; exon 6, c.748dupA; and mTOR c.5107dupA) in addition to 3 known mutations. [38]  Two thirds (n = 10) of the patients developed malignancies, all diagnosed before age 40 years; half (n = 5) died of their cancers. Three families without detectable STK11 mutations had not developed neoplasms by the time of the report.

Jang et al reported the case of a 14-year-old Korean male with Peutz-Jeghers syndrome who had complete STK11 deletion and atypical symptoms. [39]  The use of multiplex ligation-dependent probe amplification (MLPA) rather than direct sequencing revealed heterozygous deletions spanning exons 1-10. It was unclear whether his atypical symptoms of developmental delay, mental retardation, and epilepsy without tuberous sclerosis were related to Peutz-Jeghers syndrome or to another cause given his apparently healthy parents and a sibling who did not exhibit any STK11 deletions. [39]


Did this answer your question?
Additional feedback? (Optional)
Thank you for your feedback!